홈 > 미생물 검색

미생물 검색

먼저 검색하실 미생물 분류를 선택하신 후 검색 항목을 지정하여 검색하시기 바랍니다.

도움말
미생물 검색 리스트
미생물명 Bacillus sp. CLASS BACTERIA
Vial Name F4163

▷ History

Source : 두리청국장 / Medium : TSB / Final OD : ND / ProteinBSA(㎎/㎖) : 0.33 / Protease : 0.83 / Pro. 편차 : 0.05

β-amylase : -0.10 / β-A 편차 : 0.00 / Cellulase : 0.49 / Cellulase 편차 : 0.04 / Pectinase : 1.60 / Pectinase 편차 : 0.24

ACE inhibitory activity : 82.40 / ACE 편차 : 0.70 / XOD inhibitory activity : 2.40 / XOD 편차 : 0.40

SOD-like activity(%) : n.d / Antioxidant activity(%) : 12.80 / Antioxidant 편차 : 0.40 / a-Glucosidase inhibitory activity(%) : n.d

Tyrosinase inhibitory activity(%) : 2.10 / Tyrosinase 편차 : 0.30 / Fibrinolytic activity(mm) : 20.00


▷ Sequence

"GGCATCTGGCGCCAGCCAATACTGCACGTCGAGCGGACCGACGGGAGCTT
GCTCCCTTAGGTCAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCC
TGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGCTTGA
TTGAACCGCATGGTTCCATCCTAAAAGGGGGCTTTTCACTACCACTTTCC
GATGGACCCCCCGCGCATTAACTAGTTGGTGAGGTAACGGCTCCCCCAGG
CGACCAATCCTAACCCAACTGAAAAGGTGATCGGCCCCCCTGGGACTGAA
ACCCCGCCCAAAATCCTACCGGAAGCAGCAGTAGGGAATCCTCCGCAATG
GACGAAAGTCTGAAGGAACAACCCCCCGTGAGTGATGAAGGGTTTCCGAA
CGTAAAACTCTGTTGGTAGGGAAGAACAAGTACCGTTCGAATAAGGCGGG
ACCTTGACCGTACCTAACCAGAAAGCCACGGCTAACTACCTGCCAGCCGC
CCCGGTAATACCTAAGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAG
CCCGCGCAAGCCGTTTCTTAAATCTGAAGTGAAAACCCCCCGCTCCACCC
GGGAAGGTCCTTTGAAACTGGGGAACTTTAATGCAAAAAAGAAAATGGAA
TTCCCCTGTAACGGTGAAATGCTAAAGATTTGAAGAACCCAATGGCAAAG
CACTCTCTGTCTGTACTGACCTTAAGCCCAAACCTGGGAGCAACAGATTA
GATACCTGGTATCCACCCGTAACCATAATGCTAATGTAGAGGTTCCCCCT
TTATGCTGCGCAACCCTTAACACTCCCCTGGGAGACGGCGCAGATGAACT
CAAGAATGACGGGGCCGCCCAGCGTTGACCTGTGTTTATTCAAACACGCA
AGAACTTACAGGCTGACTCTCTACACCTAAAATAGGCTCCCTTCGGGCAA
GGACAGTGTGCTGGTGTCTCGCTCTGCCTGAATGTGGGTAGTCCCAACAC
CCACCTGACTAGTGCACATCATGGCATCTAGGAATCCGTACACCGAGAAG
GGGAGAGGGATCTCTCCCTTGACTGCTACCGGGGCATCGCGACAAGGGCG
AACCCAGCAACATCCGATTGTCCTTGATCGTTCGACCACCTTATGAACCG
GAACGAAACGCCGGGAACTCGGCGGTAACACCTGGCCGACTTACCCAACG
GGACTTGGGCGAGGCATGGAGGGGAGGCTGGGGGAGGAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAGGACGGGGGAGGGGTCAGCCGCACGGGCC
CAAATAGGACCCAGGCAACTTAACC
"



▷ NCBI sequence Analysis : Gene Bank Accession No. AB437939.1 / NCBI Name Bacillus l / Identity 86

▷ 배양온도 : 30℃

▷ 가격코드 : 55,000원

▷ AM : 5

목록

분양신청 Print